Sequence ID | >WENV180096174 |
Genome ID | MTBK01114675 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 458 |
End posion on genome | 373 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gagtttgttT |
tRNA gene sequence |
GCCGGCGTGGTGAAATTGGTAGACACGATAGACTCAAAATCTATTGGAGGCAACTCCATA |
Downstream region at tRNA end position |
aagaggctgt |
Secondary structure (Cloverleaf model) | >WENV180096174 Leu CAA T AAag aagaggctgt G + T C - G C - G G - C G - C C - G G - C T G T T G G C C A T A A G | | | | | G T A G T G A C C G G C G | | | T T G A C A C T A G G TGGAGGCAACTCCAT A - T T - A A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |