Sequence ID | >WENV180096187 |
Genome ID | MTBK01115778 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 807 |
End posion on genome | 720 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcgctcacgc |
tRNA gene sequence |
GGAGAGGTCGCATAGTTGGCCTAGTGCGCTCGCTTGGAAAGCGAGTATACCGCGAGGTAT |
Downstream region at tRNA end position |
cgaccaccca |
Secondary structure (Cloverleaf model) | >WENV180096187 Ser GGA c GCCt cgaccaccca G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T T G A C | | | | | G G T A C G G C G G G C G + | | | T T C G T G C C T A G TATACCGCGAGGTATC C - G T - A C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |