Sequence ID | >WENV180096201 |
Genome ID | MTBK01116271 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2293 |
End posion on genome | 2208 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aggaataaaa |
tRNA gene sequence |
GCCGCGGTGGCGGAACTGGCAGACGCAATAGGTTTAGAACCTATTAGGGTTTTCCCTGTG |
Downstream region at tRNA end position |
tattaattaa |
Secondary structure (Cloverleaf model) | >WENV180096201 Leu TAG a ACCc tattaattaa G - C C - G C - G G - C C - G G - C G - C T A T C C C T C A C A A G | | | | | A T G G C G G G G A G C G | | | T T G A C G C C A G A TAGGGTTTTCCCTGT A - T T - A A - T G - C G - C T A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |