Sequence ID | >WENV180096224 |
Genome ID | MTBK01117706 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 276 |
End posion on genome | 191 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tccgcaatgc |
tRNA gene sequence |
GGAGAGGTAGCCTAATTGGTAAGGCAGTAGTCTTGAAAACTACCGCGGGTGACCGCTTGC |
Downstream region at tRNA end position |
ttctttcctc |
Secondary structure (Cloverleaf model) | >WENV180096224 Ser TGA c GCCA ttctttcctc G - C G - C A - T G - C A - T G - C G - C T G T T G T C C A T A A A + | | | | G T T C C G G C A G G C G | | | | T T G A G G C T A A CGCGGGTGACCGCTT G - C T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |