Sequence ID | >WENV180096230 |
Genome ID | MTBK01117974 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 6135 |
End posion on genome | 6222 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gattcgaatT |
tRNA gene sequence |
GCCGGGGTGGTGGAATTGGTAGACACCAGGGACTTAAAATCCCTTGCTGCGCAAGCGGCG |
Downstream region at tRNA end position |
gatattattt |
Secondary structure (Cloverleaf model) | >WENV180096230 Leu TAA T AAaa gatattattt G - C C - G C - G G - C G - C G + T G - C G T T T G C C C A T A A G + | | | | G T G G T G G C G G G C G | | | T T G A C A C T A G C TGCTGCGCAAGCGGCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |