Sequence ID | >WENV180096231 |
Genome ID | MTBK01118031 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 122 |
End posion on genome | 31 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gttttccagt |
tRNA gene sequence |
GGAGAGGTGCCGGAGTTAGGCCGATCGGGCCTCCCTGCTAAGGAGGTGAAGGGGCAACCC |
Downstream region at tRNA end position |
acgatttggc |
Secondary structure (Cloverleaf model) | >WENV180096231 Ser GCT t GCCA acgatttggc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T T G A G | | | | | G A G G C C G T G G G C G + | | | T T G T C G G C C G A G TGAAGGGGCAACCCTTCC C - G C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |