Sequence ID | >WENV180096245 |
Genome ID | MTBK01119009 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 477 |
End posion on genome | 563 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gttcagatgt |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGCAGACGCGTTGGACTCAAAATCCAATGATGGCAACATCGTG |
Downstream region at tRNA end position |
ataattaaaa |
Secondary structure (Cloverleaf model) | >WENV180096245 Leu CAA t ACCA ataattaaaa G - C C - G C - G G - C A - T A - T G - C T G T C A C C C A C A A G | | | | | G T G G T G G T G G G C G | + | T T G A C G C C A G G TGATGGCAACATCGT T - A T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |