Sequence ID | >WENV180096249 |
Genome ID | MTBK01119340 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2319 |
End posion on genome | 2237 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctaaatttag |
tRNA gene sequence |
GCAGGCGTGGTGAAATTGGTAGACACGCATGCTTTAGGAGCATGTGGAGCAATCCATGTG |
Downstream region at tRNA end position |
agactatgtt |
Secondary structure (Cloverleaf model) | >WENV180096249 Leu TAG g ACtg agactatgtt G - C C - G A - T G - C G - C C - G G - C T G T C G C C C A T A A G | + | | | A T A G T G G T G G G C G | | | T T G A C A C T A G G TGGAGCAATCCAT C - G A - T T - A G - C C - G T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |