Sequence ID | >WENV180096253 |
Genome ID | MTBK01119427 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1814 |
End posion on genome | 1898 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aagaagacct |
tRNA gene sequence |
GTCGGGGTGGCGGAACTGGCAGACGCGCACGTTTGAGGGGCGTGTGGTGCAAACCGTGGG |
Downstream region at tRNA end position |
acaagaaacc |
Secondary structure (Cloverleaf model) | >WENV180096253 Leu GAG t ACCA acaagaaacc G - C T - A C - G G - C G - C G - C G + T T G T C C C C C A C A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGGTGCAAACCGT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |