Sequence ID | >WENV180096254 |
Genome ID | MTBK01119615 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 49832 |
End posion on genome | 49747 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtttgcgagc |
tRNA gene sequence |
GGAGGGCTGTCCGAGTGGTCGATGGTGGCTGACTTGAAATCAGCCGGGCGCAAGCCCCAG |
Downstream region at tRNA end position |
gttttttcaa |
Secondary structure (Cloverleaf model) | >WENV180096254 Ser TGA c GCCA gttttttcaa G - C G - C A - T G - C G - C G - C C - G T A T T C T C C A T G A G | | + | | G G G C C T A G G G G C G + | | T T T T G G T C G A G CGGGCGCAAGCCCC G - C C - G T - A G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |