Sequence ID | >WENV180096282 |
Genome ID | MTBK01120970 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 242 |
End posion on genome | 152 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gccatttccc |
tRNA gene sequence |
GGAGAGATGCAGGAGTGGTTGAACTGGCTCGCCTGGAAAGCGAGTATACCCCAAAAGGGT |
Downstream region at tRNA end position |
aaagcaaaaa |
Secondary structure (Cloverleaf model) | >WENV180096282 Ser GGA c GCCA aaagcaaaaa G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A T G A G | | | | | G G G G A C G G G G G C G | | | T T T A C T G T G A G TATACCCCAAAAGGGTATC C - G T - A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |