Sequence ID | >WENV180096289 |
Genome ID | MTBK01121218 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 60 |
End posion on genome | 144 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ccaccggatt |
tRNA gene sequence |
GCGCATGTGGCGGAATTGGCAGACGCGCTACTTTGAGGTGGTAGTGGAGAAATCCGTGCA |
Downstream region at tRNA end position |
tttttccccc |
Secondary structure (Cloverleaf model) | >WENV180096289 Leu GAG t ACCA tttttccccc G - C C - G G - C C - G A - T T - A G - C T G T C G T C C A T A A G | | | | | A T G G C G G C A G G C G | | | T T G A C G C C A G G TGGAGAAATCCGT C - G T - A A - T C - G T + G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |