Sequence ID | >WENV180096292 |
Genome ID | MTBK01121521 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 359 |
End posion on genome | 448 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cagtacgaac |
tRNA gene sequence |
GGAAGGGTGGCTGAGTGGTCTAAGGCGCCTGACTCGAAATCAGGAGATGTCGCAAGGCAT |
Downstream region at tRNA end position |
ttcccgtaaa |
Secondary structure (Cloverleaf model) | >WENV180096292 Ser CGA c GCCA ttcccgtaaa G - C G - C A - T A - T G - C G + T G - C T A T C C C T C A T G A G | | | | | G G G T C G G G G A G C G + | | T T T A G G C C T A G AGATGTCGCAAGGCATCC C - G C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |