Sequence ID | >WENV180096302 |
Genome ID | MTBK01122094 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 900 |
End posion on genome | 817 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agtttttcaa |
tRNA gene sequence |
GCGCGGGTGGTGAAATGGCAGACACGCATCCTTGAGGTGGATGTGTCCGTAAGGACGTGG |
Downstream region at tRNA end position |
aaaaataatg |
Secondary structure (Cloverleaf model) | >WENV180096302 Leu GAG a ACtg aaaaataatg G - C C - G G - C C - G G - C G - C G - C T C T T C T C C A T A A G + | | | | G G A G T G G G A G G C G | | | T T C A C A C A G G TGTCCGTAAGGACGT C - G A - T T - A C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |