Sequence ID | >WENV180096305 |
Genome ID | MTBK01122389 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 509 |
End posion on genome | 595 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atgtcttttg |
tRNA gene sequence |
GGAGGGGTGTCCGAGCGGTTTAAGGAGCTAGTCTTGAAAACTAGTGACCCGAAAGGGCCG |
Downstream region at tRNA end position |
gcagacacga |
Secondary structure (Cloverleaf model) | >WENV180096305 Ser TGA g GCCA gcagacacga G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGACCCGAAAGGGCC C - G T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |