Sequence ID | >WENV180096309 |
Genome ID | MTBK01122641 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 287 |
End posion on genome | 201 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
ccgtcgttgc |
tRNA gene sequence |
GCGGGGGTGGTGGAACAGGTAGACACGCAAGGCTAAGGACCTTGTGGCCGCGAGGCTGTG |
Downstream region at tRNA end position |
tagcttgata |
Secondary structure (Cloverleaf model) | >WENV180096309 Leu AAG c ACCA tagcttgata G - C C - G G - C G - C G + T G - C G - C T G T C C C T C A C A A G | | | | | G A G G T G G G G A G C G | | | T T G A C A C T A G G TGGCCGCGAGGCTGT C - G A - T A - T G - C G - C C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |