Sequence ID | >WENV180096313 |
Genome ID | MTBK01122984 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1333 |
End posion on genome | 1250 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaaacctttt |
tRNA gene sequence |
GGAGGAATAGCGAAGTGGCTAAACGCGACGGACTGTAAATCCGTTCCTTAGGGTTCAGTG |
Downstream region at tRNA end position |
ttggggtata |
Secondary structure (Cloverleaf model) | >WENV180096313 Tyr GTA t ACCA ttggggtata G - C G - C A - T G - C G - C A - T A - T T A T T C A C C A T G A A | | | | | G G A G C G A G T G G C G | | | T T C A C G C T A A G TCCTTAGGGTTC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |