Sequence ID | >WENV180096329 |
Genome ID | MTBK01123947 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 375 |
End posion on genome | 467 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
acgcacaccc |
tRNA gene sequence |
GGAGAGGTACCGAAGTGGTCATAACGGCGCCGACTCGAAATCGGATGGTCGGTTAATCCC |
Downstream region at tRNA end position |
ttttctgatc |
Secondary structure (Cloverleaf model) | >WENV180096329 Ser CGA c GCCA ttttctgatc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C C G T G G G C T | | | T T C A C G G A T A C TGGTCGGTTAATCCCGGCAC G A C - G C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |