Sequence ID | >WENV180096336 |
Genome ID | MTBK01124167 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 503 |
End posion on genome | 416 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttcacaatat |
tRNA gene sequence |
GCCGAAGTGGTGAAATAGGTAGACGCAGTGGACTCAAAATCCACCGGGCTTTTAGCCCGT |
Downstream region at tRNA end position |
ttaactaagt |
Secondary structure (Cloverleaf model) | >WENV180096336 Leu CAA t ACCA ttaactaagt G - C C - G C - G G - C A - T A - T G - C T T T C G G C C A T A A G | | | | | G A A G T G G C C G G C G | + | T T G A C G C T A G A CGGGCTTTTAGCCCGT G - C T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |