Sequence ID | >WENV180096350 |
Genome ID | MTBK01125171 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 47479 |
End posion on genome | 47552 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgttgtgcac |
tRNA gene sequence |
GCCATCTTAGCTCAGTTGGGAGAGCGCGTGACTTGTAATCTCGAGGTCCCCGGTTCGATT |
Downstream region at tRNA end position |
gggacttatg |
Secondary structure (Cloverleaf model) | >WENV180096350 Thr TGT c TCga gggacttatg G - C C - G C - G A - T T - A C - G T - A T T T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G AGGTC C - G G - C T T G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |