Sequence ID | >WENV180096351 |
Genome ID | MTBK01125171 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 47575 |
End posion on genome | 47658 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gtccatcaat |
tRNA gene sequence |
GGGGAGATTCCCGAGTGGTCAAAGGGGGCAGACTGTAAATCTGTTGGCTGTAGCCTTCGA |
Downstream region at tRNA end position |
ggggttgtcc |
Secondary structure (Cloverleaf model) | >WENV180096351 Tyr GTA t ACaa ggggttgtcc G - C G - C G - C G - C A - T G - C A - T T A T C T T C C A T G A T | | | | | A G G C C C G A A G G C G | | | T T T A G G G C A A G TGGCTGTAGCCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |