Sequence ID | >WENV180096379 |
Genome ID | MTBK01126579 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 124127 |
End posion on genome | 124054 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttacggacgc |
tRNA gene sequence |
TGGGAGATCGTCTAATGGTAGGACTGCAGTCTCTGGATCTGCCTATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
atttcttagt |
Secondary structure (Cloverleaf model) | >WENV180096379 Gln CTG c GCCA atttcttagt T - A G - C G - C G - C A - T G - C A - T T A T G T C C C A A A C | + | | | G T T C T G C G G G G C G + | | | T T G G G A C T A T CTAT G - C C - G A - T G - C T T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |