Sequence ID | >WENV180096390 |
Genome ID | MTBK01127266 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2054 |
End posion on genome | 2137 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tttgatccca |
tRNA gene sequence |
GGCAGGTTGCCCGAGCGGCCAATGGGAGCGGACTGTAAATCCGTCGGCGAAAGCCTACAC |
Downstream region at tRNA end position |
tgttttctca |
Secondary structure (Cloverleaf model) | >WENV180096390 Tyr GTA a ACgc tgttttctca G - C G - C C - G A - T G - C G - C T - A T A T T G T C C A C G A G | | | | | G G G C C C A C A G G C G + | | | T T C T G G G C A A A CGGCGAAAGCCTAC G + T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |