Sequence ID | >WENV180096400 |
Genome ID | MTBK01127456 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 303 |
End posion on genome | 377 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcgcgccaga |
tRNA gene sequence |
TGGGGCGTGGCCAAGTGGTAAGGCACCAGCCTTTGGAGCTGACATTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
tgtggggcca |
Secondary structure (Cloverleaf model) | >WENV180096400 Gln TTG a GCCA tgtggggcca T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A G | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC C A C - G A - T G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |