Sequence ID | >WENV180096407 |
Genome ID | MTBK01127766 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11687 |
End posion on genome | 11612 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgtaagcgt |
tRNA gene sequence |
AGGCCCGTAGCTCCAACGGTAGAGCAGCGGTCTCCAAAACCGACGGATGGGGGTTCGAAT |
Downstream region at tRNA end position |
ttaactttca |
Secondary structure (Cloverleaf model) | >WENV180096407 Trp CCA t GCCA ttaactttca A - T G - C G - C C - G C - G C - G G - C T A T C T C C C A A A C A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A CGGAT G A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |