Sequence ID | >WENV180096412 |
Genome ID | MTBK01128163 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 800 |
End posion on genome | 727 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aatatattga |
tRNA gene sequence |
GGCGCTATAGCCAAGTGGTAAGGCACAGGTCTGCAACACCTAGATCTCCAGTTCAAATCT |
Downstream region at tRNA end position |
aaatattttt |
Secondary structure (Cloverleaf model) | >WENV180096412 Cys GCA a TCCA aaatattttt G - C G - C C - G G - C C - G T + G A - T T A T A G G T C A G A A | | | | | A T A C C G T C C A G C G | | | T T G A G G C T A A GATC C A A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |