Sequence ID | >WENV180096436 |
Genome ID | MTBK01129231 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2039 |
End posion on genome | 1951 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aaattaattt |
tRNA gene sequence |
GGAGGCGTGTACCGAATCGGCTAAGGGGCCGGTCTCGAAAACCGGTGGGGTTTATCCCCG |
Downstream region at tRNA end position |
taaaagaact |
Secondary structure (Cloverleaf model) | >WENV180096436 Ser CGA t GCCA taaaagaact G - C G - C A - T G - C G - C C - G G - C T G T C A C C C A T A A G G | | | | | G C C C A T G T G G G C G | + T T G A G G G C T A G TGGGGTTTATCCCCGT C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |