Sequence ID | >WENV180096444 |
Genome ID | MTBK01129753 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1482 |
End posion on genome | 1393 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
nnnaaatatt |
tRNA gene sequence |
GGAGGGTTGTCCGAGAGGTCGAAGGAGATGGTCTCGAAAATCATTATACCCTTACGGGTA |
Downstream region at tRNA end position |
agttataagc |
Secondary structure (Cloverleaf model) | >WENV180096444 Ser CGA t GCCA agttataagc G - C G - C A - T G - C G - C G - C T - A T A T A T C C C A A G A G | | | | | A G G C C T T A G G G C G | | | T T T A G G A C G A G TATACCCTTACGGGTATC A - T T - A G - C G + T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |