Sequence ID | >WENV180096448 |
Genome ID | MTBK01129902 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12318 |
End posion on genome | 12409 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttttttaaat |
tRNA gene sequence |
GGAGAGGTGACCGAGCAGGTTTAAGGTGCACGCCTGCTAAGCGTGTGTGGGTCAAAAGCT |
Downstream region at tRNA end position |
gaatttgttg |
Secondary structure (Cloverleaf model) | >WENV180096448 Ser GCT t GCCA gaatttgttg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A A C G A G | | | | | A G G C C A G T G G G C G | | | T T T A G G T T T A G TGTGGGTCAAAAGCTCACC C - G A - T C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |