Sequence ID | >WENV180096449 |
Genome ID | MTBK01129902 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12418 |
End posion on genome | 12492 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cagaatttgt |
tRNA gene sequence |
TGGGCAGTCGCCAAGCGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCGGGGGTTCGAATC |
Downstream region at tRNA end position |
gattttttta |
Secondary structure (Cloverleaf model) | >WENV180096449 Gln TTG t GCCA gattttttta T - A G - C G - C G - C C - G A - T G - C T A T C C T C C A G A C | | + | | G C A C C G G G G G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |