Sequence ID | >WENV180096462 |
Genome ID | MTBK01130462 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3125 |
End posion on genome | 3210 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tatataaatt |
tRNA gene sequence |
GCCCGGGTGGCGGAATCGGCAGACGCGTTGGACTCAAAATCCAATGACCTTTTCGGTCAT |
Downstream region at tRNA end position |
acgaatgaaa |
Secondary structure (Cloverleaf model) | >WENV180096462 Leu CAA t ACaa acgaatgaaa G - C C - G C - G C - G G - C G - C G - C T G T C T C T C A T A A G | | | | | G C G G C G G A G A G C G | | | T T G A C G C C A G G TGACCTTTTCGGTCAT T - A T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |