Sequence ID | >WENV180096483 |
Genome ID | MTBK01131580 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8367 |
End posion on genome | 8288 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cagcaaaccc |
tRNA gene sequence |
GCCCAGATGGTGGAATTGGCAGACACGCTAGATTCAGGTTCTAGTGCGAAAGCATGGGGG |
Downstream region at tRNA end position |
tcatatataa |
Secondary structure (Cloverleaf model) | >WENV180096483 Leu CAG c Aaat tcatatataa G - C C - G C - G C - G A - T G - C A - T T G T C C C C C A T A A G | | | | | A T G G T G G G G G G C G | | | T T G A C A C C A G G TGCGAAAGCAT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |