Sequence ID | >WENV180096499 |
Genome ID | MTBK01132673 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 144 |
End posion on genome | 60 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcaactgctT |
tRNA gene sequence |
AGGTGGGTAGCATAATCGGTAATGCAGCGGTCTCCAAAACCGTGAGCGAAAGCTCTATGA |
Downstream region at tRNA end position |
ttttccagcc |
Secondary structure (Cloverleaf model) | >WENV180096499 Trp CCA T GTtt ttttccagcc A - T G - C G - C T + G G - C G - C G - C T A T T T T C C A T A A A + | + | | G C T A C G G A G G G C G | | | | T T G A T G C T A A GAGCGAAAGCTCTAT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |