Sequence ID | >WENV180096504 |
Genome ID | MTBK01132960 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 621 |
End posion on genome | 534 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cttttgcatc |
tRNA gene sequence |
GGAGAAATGGCAGAGCGGTCGAATGCGGCGGTCTTGAAAACCGTTGAACCGAGAGGTTCC |
Downstream region at tRNA end position |
aacagttaaa |
Secondary structure (Cloverleaf model) | >WENV180096504 Ser TGA c GCCA aacagttaaa G - C G - C A - T G - C A - T A - T A - T T A T C T C C C A C G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGAACCGAGAGGTTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |