Sequence ID | >WENV180096517 |
Genome ID | MTBK01133872 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1326 |
End posion on genome | 1254 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tggtgctatt |
tRNA gene sequence |
GCCTCGGTAGCTCAGTGGTAGAGCATAGGACTGAAAATCCTTGTGTCGTCAGTTCGATTC |
Downstream region at tRNA end position |
tttatcgggg |
Secondary structure (Cloverleaf model) | >WENV180096517 Phe GAA t ACtt tttatcgggg G - C C - G C - G T + G C - G G - C G - C T T T C A G T C A G A A | | | | | G T C T C G G T C A G C G | | | | T T G G A G C T A A GTGTC T T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |