Sequence ID | >WENV180096528 |
Genome ID | MTBK01134450 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 386 |
End posion on genome | 469 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgtttgccc |
tRNA gene sequence |
GGAGGGGTAGCCTAATTGGTAAGGCACCGGTCTTGAAAACCGGCGGTTTCGGCCTTGCGG |
Downstream region at tRNA end position |
gattttattg |
Secondary structure (Cloverleaf model) | >WENV180096528 Ser TGA c GCCA gattttattg G - C G - C A - T G - C G - C G - C G - C T G T C G C C C A T A A A | | | | | G T T C C G G C G G G C G | | | | T T G A G G C T A A CGGTTTCGGCCTT C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |