Sequence ID | >WENV180096533 |
Genome ID | MTBK01134925 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 737 |
End posion on genome | 653 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tctcgcatcc |
tRNA gene sequence |
GCCGGCGTGGTGAAATTGGTAGACACGTCAGACTCAAAATCTGATGGATGAATAATCCGT |
Downstream region at tRNA end position |
gaaaccctac |
Secondary structure (Cloverleaf model) | >WENV180096533 Leu CAA c Aact gaaaccctac G + T C - G C - G G - C G - C C - G G - C T T T T A G C C A T A A G | | | | | G T A G T G A T C G G C G | | | T T G A C A C T A G G TGGATGAATAATCCGT T - A C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |