Sequence ID | >WENV180096534 |
Genome ID | MTBK01134963 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2581 |
End posion on genome | 2493 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
taaaaaccgt |
tRNA gene sequence |
GCCGAGGTGGCGGAATAGGCAGACGCAGTGGACTCAAAATCCACCGGGCTTCACCACCCA |
Downstream region at tRNA end position |
gcgctttatg |
Secondary structure (Cloverleaf model) | >WENV180096534 Leu CAA t ACCA gcgctttatg G - C C - G C - G G - C A - T G - C G - C T C T C G C C C A T A A G | | | | | G A G G C G G C G G G C G | | | T T G A C G C C A G A CGGGCTTCACCACCCAT G - C T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |