Sequence ID | >WENV180096545 |
Genome ID | MTBK01135377 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 568 |
End posion on genome | 652 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaataaaagc |
tRNA gene sequence |
GGGTCGGTGGCCGAGTGGTTAATGGCAGCAGACTGTAAATCTGCCGGCGTAATGCCTACG |
Downstream region at tRNA end position |
cttctgcggg |
Secondary structure (Cloverleaf model) | >WENV180096545 Tyr GTA c ACag cttctgcggg G - C G - C G - C T + G C - G G - C G - C C A T C T A C C A T G A G | + | | | G G G C C G G G T G G C G + | | | T T T T G G C T A A A CGGCGTAATGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |