Sequence ID | >WENV180096548 |
Genome ID | MTBK01135504 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1424 |
End posion on genome | 1348 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gacaattagt |
tRNA gene sequence |
TGGGATATAGCCAAGTCGGTAAGGCAACGGACTTTGACTCCGTCATTTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tataagaatt |
Secondary structure (Cloverleaf model) | >WENV180096548 Gln TTG t GCCA tataagaatt T - A G - C G - C G - C A - T T - A A - T T G T C G T C C A T G A A | | | | | G C A C C G G C A G G C G | | | T T G A G G C T A A CATTTC A - T C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |