Sequence ID | >WENV180096549 |
Genome ID | MTBK01135504 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1237 |
End posion on genome | 1149 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctctaaatcc |
tRNA gene sequence |
GGAGGGGTGTCCGAGTGGCTTAAGGAGCTGGTCTTGAAAACCAGTGACTCCGTAAGGGGC |
Downstream region at tRNA end position |
aaataatatt |
Secondary structure (Cloverleaf model) | >WENV180096549 Ser TGA c GCCA aaataatatt G - C G - C A - T G - C G - C G - C G - C T A T C G T C C A T G A G | | + | | A G G C C T G C G G G C G | | | T T C A G G A T T A G TGACTCCGTAAGGGGCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |