Sequence ID | >WENV180096550 |
Genome ID | MTBK01135504 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1069 |
End posion on genome | 978 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggtttaaaaa |
tRNA gene sequence |
GGAGAAGTACTCAAGTCGGCTGAAGAGGATGGTTTGCTAAACCATTAGATCGTGTAAGCG |
Downstream region at tRNA end position |
ttatttacta |
Secondary structure (Cloverleaf model) | >WENV180096550 Ser GCT a GCCA ttatttacta G - C G - C A - T G - C A - T A - T G - C T A T C G C C C A C T G A A | | | | | G G A C T C G C G G G C G | | | T T C A G A G T G A G TAGATCGTGTAAGCGATGC A - T T - A G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |