Sequence ID | >WENV180096567 |
Genome ID | MTBK01136005 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 28257 |
End posion on genome | 28184 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tccggagcat |
tRNA gene sequence |
GCGGGTGTAGTTTAGTGGTAGAACATCAGCCTTCCAAGCTGATCGTGAGAGTTCGATTCT |
Downstream region at tRNA end position |
caaatccggg |
Secondary structure (Cloverleaf model) | >WENV180096567 Gly TCC t TCCA caaatccggg G - C C - G G - C G - C G - C T - A G - C T T T T T C T C A G A A + | | | | G T T T T G G A G A G C G + | | | T T G G A A C T A A TCGT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |