Sequence ID | >WENV180096598 |
Genome ID | MTBK01137669 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 7071 |
End posion on genome | 7000 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccatatttaa |
tRNA gene sequence |
GGTCTCGTGGCCGAGTGGCTAGGCACAGGTCTGCAAAACCTCGTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
cattgagata |
Secondary structure (Cloverleaf model) | >WENV180096598 Cys GCA a TCaa cattgagata G - C G - C T - A C - G T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A GTAC C C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |