Sequence ID | >WENV180096601 |
Genome ID | MTBK01137953 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 693 |
End posion on genome | 778 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctttttttaT |
tRNA gene sequence |
GCCCGGATGGCGGAATTGGTAGACGCGCTAGTTTCAGGGACTAGTACTGTCACAAGTGTG |
Downstream region at tRNA end position |
aatgaaatta |
Secondary structure (Cloverleaf model) | >WENV180096601 Leu CAG T ATta aatgaaatta G - C C - G C - G C - G G - C G - C A - T T G T T G T C C A T A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C T A G G TACTGTCACAAGTGT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |