Sequence ID | >WENV180096602 |
Genome ID | MTBK01137969 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8312 |
End posion on genome | 8222 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccgtggttca |
tRNA gene sequence |
GGAGGCGTGCCAGAGCGGCCGAATGGGACTCACTGCTAATGAGTTGTCCCCCTTAAAGGG |
Downstream region at tRNA end position |
cggctgtttc |
Secondary structure (Cloverleaf model) | >WENV180096602 Ser GCT a GCCg cggctgtttc G - C G - C A - T G - C G - C C - G G - C T A T T C T C C A C G A G + | | | | A G G A C C G G A G G C G | | | T T C A T G G C G A G TGTCCCCCTTAAAGGGGACC A - T C - G T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |