Sequence ID | >WENV180096612 |
Genome ID | MTBK01138446 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 256 |
End posion on genome | 173 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccaaaacttt |
tRNA gene sequence |
GCGGCCGTGGCGGAACTGGCAGACGCGCTAGACTTAGGATCTAGTCTCTTAGAGGTGGGA |
Downstream region at tRNA end position |
gctatgggaa |
Secondary structure (Cloverleaf model) | >WENV180096612 Leu TAG t ACCA gctatgggaa G - C C - G G - C G - C C - G C - G G - C T G T T T C T C A C A A G + + | | | A T G G C G G G G A G C G | | | T T G A C G C C A G G TCTCTTAGAGGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |