Sequence ID | >WENV180096618 |
Genome ID | MTBK01138777 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 253 |
End posion on genome | 343 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atattttttt |
tRNA gene sequence |
GGAGAAGTACTCAAGTTGGTGAAGAGGCACCCCTGCTAAGGGTGTAGGTCGGGGAACCGG |
Downstream region at tRNA end position |
agcggttgta |
Secondary structure (Cloverleaf model) | >WENV180096618 Ser GCT t GCCA agcggttgta G - C G - C A - T G - C A - T A - T G - C T G T C C C T C A T G A A | | | | | G T A C T C G G G A G C G | | | T T G A G A G T G A G TAGGTCGGGGAACCGGCGC C - G A - T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |