Sequence ID | >WENV180096626 |
Genome ID | MTBK01139623 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2197 |
End posion on genome | 2125 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gctcttcaat |
tRNA gene sequence |
GCCAATGTAGCTCAGCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACGGGTTCAATTC |
Downstream region at tRNA end position |
aaattaaatt |
Secondary structure (Cloverleaf model) | >WENV180096626 Thr GGT t TCag aaattaaatt G - C C - G C - G A C A - T T - A G - C T T T T G C C C A G A A | | | | | A C C T C G A C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |