Sequence ID | >WENV180096641 |
Genome ID | MTBK01140530 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12012 |
End posion on genome | 11927 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caaaatgggt |
tRNA gene sequence |
GCGAAGGTGGCGGAACTGGCAGACGCGCTGGACTTAGGATCCAGTGGGCTAAACCCGTGC |
Downstream region at tRNA end position |
ttttttatta |
Secondary structure (Cloverleaf model) | >WENV180096641 Leu TAG t ACCA ttttttatta G - C C - G G - C A - T A - T G - C G - C T A T C G C C C A C A A G | | | | | A T G G C G G C G G G C G | | | T T G A C G C C A G G TGGGCTAAACCCGT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |